lasergene version 5 0 6 (DNASTAR)
DNASTAR is a verified supplier 
DNASTAR manufactures this product 
99
Structured Review
DNASTAR
lasergene version 5 0 6
Lasergene Version 5 0 6, supplied by DNASTAR, used in various techniques. Bioz Stars score: 99/100, based on 10685 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lasergene+version+5+0+6/Lasergene/pmc11186114-128-11-14
Average 99 stars, based on 10685 article reviews
Lasergene Version 5 0 6, supplied by DNASTAR, used in various techniques. Bioz Stars score: 99/100, based on 10685 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lasergene+version+5+0+6/Lasergene/pmc11186114-128-11-14
Average 99 stars, based on 10685 article reviews
lasergene version 5 0 6 - by Bioz Stars,
2026-09
99/100 stars
Images
Related Articles
Sequencing:Article Title: Molecular detection of severe fever with thrombocytopenia syndrome and tick-borne encephalitis viruses in ixodid ticks collected from vegetation, Republic of Korea, 2014. Article Snippet: Sequencing was performed with T7 promotor (5 ́-TAATACGACTCACTATAGGG-3 ́) and M13R-pUC (5 ́-CAGGAAACAGCTATGAC-3 ́) primers using an ABI Prism BigDye TM v3.1 Terminator Cycle Sequencing Kit and an ABI 3730xl Sequencer (Applied Biosystems, Foster City, USA) at Macrogen Inc. (Daejeon, ROK). .. Sequencing results were aligned using SeqMan PRO, Article Title: First detection of tick‐borne encephalitis virus (TBEV) in raw milk samples in North‐Western Iran Article Snippet: Sequencing was conducted by T7 promotor (5‐TAATACGACTCACTATAGGG‐3) and M13R‐pUC (5‐CAGGAAACAGCTATGAC‐3) primers using an ABI Prism BigDyeTMv3.1 Terminator Cycle Sequencing Kit and an ABI 3730xl Sequencer (Applied Biosystems) at Macrogen Inc. .. The sequencing results were aligned with the help of SeqMan PRO, |